Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Ismail Muhammad, Tanko Mahmoud Mohammed, Asiya Muhammad Usman, Bala Abubakar

Abstract

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.

10.22178/pos.89-21


Keywords


Malaria Diagnosis; Polymerase Chain Reaction; Microscopy; Sensitivity; Specificity; Accuracy

Full Text:

PDF


References


1. Edem, E. N., Mbong, E. O., & Hussain, S. (2020). Accuracy of Malaria Diagnosis by Microscopy and RDT Methods amongst Pregnant Women Attending Antenatal Clinic in Eket. Journal Of Infectious Diseases and Diagnosis, 15(3), 1–3.

2. Adeola, O., Oluyomi, S., Sola, A., Bassey, O., Oluwagbemiga, A., &Olusola, A. (2018). Performance of Microscopy Method and Rapid Diagnostic Tests in Malaria Diagnosis amongst Pregnant Women in Lagos, Southwest Nigeria. Diversity and Equality in Health and Care, 15(3), 104–109.

3. Yaya, S., Bishwajit, G., Ekholuenetale, M., Shah, V., Kadio, B., & Udenigwe, O. (2017). Knowledge of prevention, cause, symptom and practices of malaria among women in Burkina Faso. PLOS ONE, 12(7), e0180508. doi: 10.1371/journal.pone.0180508

4. Obimakinde, E. T., Simon-Oke I., & Osunyemi, O. S. (2018). The effectiveness of microscopy: Rapid diagnostic test and molecular assay in diagnosing malaria. Journal of Parasitic Diseases: Diagnosis and Therapy, 3(1). doi: 10.4066/2591-7846.1000022

5. Musbau, S., Bala, U., Umar, Y. D. (2014). Prevalence of Malaria Parasite Infection among Pregnant Women Attending General Sani Abacha Specialist Hospital Damaturu. Scholars Journal of Applied Medical Sciences , 2(6F), 3281–3283.

6. Muhammad, I., Abubakar, B., Mohammed, M. T., Abdullahi, A., & Asiya, M. (2022). Determination of malaria rapid diagnostic test effectiveness compared to microscopy (Gold standard). DYSONA-Life Science, 3, 49–56.

7. Sixpence, A., Nkoka, O., Chirwa, G. C., Milanzi, E. B., Mangani, C., Mathanga, D. P., & Ntenda, P. A. M. (2020). Levels of knowledge regarding malaria causes, symptoms, and prevention measures among Malawian women of reproductive age. Malaria Journal, 19(1). doi: 10.1186/s12936-020-03294-6

8. Mbanefo, A., & Kumar, N. (2020). Evaluation of Malaria Diagnostic Methods as a Key for Successful Control and Elimination Programs. Tropical Medicine and Infectious Disease, 5(2), 102. doi: 10.3390/tropicalmed5020102

9. DePina, A. J., Dia, A. K., de Ascenção Soares Martins, A., Ferreira, M. C., Moreira, A. L., Leal, S. V., Pires, C. M., Moreira, J. M. G., Tavares, M. F., da Moura, A. J. F., Pereira, J. M., Faye, O., Seck, I., & Niang, E. H. A. (2019). Knowledge, attitudes and practices about malaria in Cabo Verde: a country in the pre-elimination context. BMC Public Health, 19(1). doi: 10.1186/s12889-019-7130-5

10. Danwang, C., Noubiap, J. J., Souopgui, J., Gaudart, J., Yombi, J. C., & Robert, A. (2021). Accuracy of malaria diagnostic tests performed on non-invasively collected samples: a systematic review and meta-analysis. BMJ Global Health, 6(6), e005634. doi: 10.1136/bmjgh-2021-005634

11. Hathiwala, R., Mehta, P. R., Nataraj, G., & Hathiwala, S. (2017). LED fluorescence microscopy: Novel method for malaria diagnosis compared with routine methods. Journal of Infection and Public Health, 10(6), 824–828. doi: 10.1016/j.jiph.2017.01.001

12. Fransisca, L., Kusnanto, J. H., Satoto, T. B. T., Sebayang, B., Supriyanto, ᅟ, Andriyan, E., & Bangs, M. J. (2015). Comparison of rapid diagnostic test Plasmotec Malaria-3, microscopy, and quantitative real-time PCR for diagnoses of Plasmodium falciparum and Plasmodium vivax infections in Mimika Regency, Papua, Indonesia. Malaria Journal, 14(1). doi: 10.1186/s12936-015-0615-5

13. Zaki, W., & Madkhali, A. (2016). Accuracy of immunochromatography diagnostic test versus microscopy in the diagnosis of malaria among clinically suspected patients in Jazan area, KSA. Parasitologists United Journal, 9(2), 95. doi: 10.4103/1687-7942.205164

14. Kitutu, F. E., Wamani, H., Selling, K. E., Katabazi, F. A., Kuteesa, R. B., Peterson, S., Kalyango, J. N., & Mårtensson, A. (2018). Can malaria rapid diagnostic tests by drug sellers under field conditions classify children 5 years old or less with or without Plasmodium falciparum malaria? Comparison with nested PCR analysis. Malaria Journal, 17(1). doi: 10.1186/s12936-018-2508-x

15. Badiane, A., Thwing, J., Williamson, J., Rogier, E., Diallo, M. A., & Ndiaye, D. (2022). Sensitivity and specificity for malaria classification of febrile persons by rapid diagnostic test, microscopy, parasite DNA, histidine-rich protein 2, and IgG: Dakar, Senegal 2015. International Journal of Infectious Diseases, 121, 92–97. doi: 10.1016/j.ijid.2022.04.060

16. Ricciardi, A., & Ndao, M. (2015). Diagnosis of Parasitic Infections: What’s Going On? SLAS Discovery, 20(1), 6–21. doi: 10.1177/1087057114548065

17. Nijhuis, R. H. T., van Lieshout, L., Verweij, J. J., Claas, E. C. J., & Wessels, E. (2018). Multiplex real-time PCR for diagnosing malaria in a non-endemic setting: a prospective comparison to conventional methods. European Journal of Clinical Microbiology & Infectious Diseases, 37(12), 2323–2329. doi: 10.1007/s10096-018-3378-4

18. Gupta, P., Gupta, P., Rao, S., Singh, N., & Kalita, D. (2018). Comparison Between Microscopy And Rapid Diagnostic Tests In Diagnosis Of Malaria At A Tertiary Care Medical Institution In Uttarakhand (A 3-Year Study). Asian Journal of Pharmaceutical and Clinical Research, 11(2), 94. doi: 10.22159/ajpcr.2018.v11i2.22141

19. Oboh, M. A., Oriero, E. C., Ndiaye, T., Badiane, A. S., Ndiaye, D., & Amambua-Ngwa, A. (2021). Comparative analysis of four malaria diagnostic tools and implications for malaria treatment in southwestern Nigeria. International Journal of Infectious Diseases, 108, 377–381. doi: 10.1016/j.ijid.2021.05.049

20. Richardson, D. C., Ciach, M., Zhong, K. J. Y., Crandall, I., & Kain, K. C. (2002). Evaluation of the Makromed Dipstick Assay versus PCR for Diagnosis of Plasmodium falciparum Malaria in Returned Travelers. Journal of Clinical Microbiology, 40(12), 4528–4530. doi: 10.1128/jcm.40.12.4528-4530.2002

21. Nair, C. B., Manjula, J., Subramani, P. A., Nagendrappa, P. B., Manoj, M. N., Malpani, S., Pullela, P. K., Subbarao, P. V., Ramamoorthy, S., & Ghosh, S. K. (2016). Differential Diagnosis of Malaria on Truelab Uno®, a Portable, Real-Time, MicroPCR Device for Point-Of-Care Applications. PLOS ONE, 11(1), e0146961. doi: 10.1371/journal.pone.0146961

22. Siwal, N., Singh, U. S., Dash, M., Kar, S., Rani, S., Rawal, C., Singh, R., Anvikar, A. R., Pande, V., & Das, A. (2018). Malaria diagnosis by PCR revealed differential distribution of mono and mixed species infections by Plasmodium falciparum and P. vivax in India. PLOS ONE, 13(3), e0193046. doi: 10.1371/journal.pone.0193046

23. Wardhani, P., Butarbutar, T. V., Adiatmaja, C. O., Betaubun, A. M., Hamidah, N., & Aryati. (2020). Performance Comparison of Two Malaria Rapid Diagnostic Test with Real Time Polymerase Chain Reaction and Gold Standard of Microscopy Detection Method. Infectious Disease Reports, 12(11), 8731. doi: 10.4081/idr.2020.8731

24. Londono, B. L., Eisele, T. P., Keating, J., Bennett, A., Chattopadhyay, C., Heyliger, G., Mack, B., Rawson, I., Vely, J.-F., Désinor, O., & Krogstad, D. J. (2009). Chloroquine-Resistant HaplotypePlasmodium falciparumParasites, Haiti. Emerging Infectious Diseases, 15(5), 735–740. doi: 10.3201/eid1505.081063

25. Hernandez-Valladares, M., Rihet, P., & Iraqi, F. A. (2014). Host susceptibility to malaria in human and mice: compatible approaches to identify potential resistant genes. Physiological Genomics, 46(1), 1–16. doi: 10.1152/physiolgenomics.00044.2013

26. Rifaie-Graham, O., Pollard, J., Raccio, S., Balog, S., Rusch, S., Hernández-Castañeda, M. A., Mantel, P.-Y., Beck, H.-P., & Bruns, N. (2019). Hemozoin-catalyzed precipitation polymerization as an assay for malaria diagnosis. Nature Communications, 10(1). doi: 10.1038/s41467-019-09122-z

27. Rodulfo, H., De Donato, M., Mora, R., González, L., & Contreras, C. E. (2007). Comparison of the diagnosis of malaria by microscopy, immunochromatography and PCR in endemic areas of Venezuela. Brazilian Journal of Medical and Biological Research, 40(4), 535–543. doi: 10.1590/s0100-879x2007000400012

28. Wilson, M. L. (2013). Laboratory Diagnosis of Malaria: Conventional and Rapid Diagnostic Methods. Archives of Pathology & Laboratory Medicine, 137(6), 805–811. doi: 10.5858/arpa.2011-0602-ra

29. Efunshile, M., Amoo, A. O. J., Akintunde, G. B., Ojelekan, O. D., König, W., & König, B. (2011). Use and Effects of Malaria Control Measures in Pregnancy in Lagos, Nigeria. The Korean Journal of Parasitology, 49(4), 365. doi: 10.3347/kjp.2011.49.4.365

30. Masanja, I. M., McMorrow, M. L., Maganga, M. B., Sumari, D., Udhayakumar, V., McElroy, P. D., Kachur, S. P., & Lucchi, N. W. (2015). Quality assurance of malaria rapid diagnostic tests used for routine patient care in rural Tanzania: microscopy versus real-time polymerase chain reaction. Malaria Journal, 14(1). doi: 10.1186/s12936-015-0597-3

31. Wangai, L., Karau, M., Njiruh, P., Sabah, O., Kimani, F., Magoma, G., & Kiambo, N. (2011). Sensitivity of microscopy compared to molecular diagnosis of P. falciparum: Implications on malaria treatment in epidemic areas in Kenya. African Journal of Infectious Diseases, 5(1). doi: 10.4314/ajid.v5i1.66504

32. Uba, C. C., Ikegbunam, M. N., Anagor, I. S., Eleanya, L. C., Ezeumeh, E. N., Ezekwueche, S. N., Okechukwu, E. C., & Esimone, C. O. (2021). Comparative Performance of Different Malaria Diagnostic Tools among Pregnant Cohorts in Onitsha Southeast Nigeria. Advances in Infectious Diseases, 11(04), 384–394. doi: 10.4236/aid.2021.114035

33. Khan, S. A., Ahmed, S., Mushahid, N., Anwer, M., Saeed, S., Khan, F. A., Shamshad, G. U., & Joyia, Z. (2013). Comparison of real time polymerase chain reaction with microscopy and antigen detection assay for the diagnosis of malaria. Journal of the College of Physicians and Surgeons--Pakistan: JCPSP, 23(10), 787–792.

34. Adiatmaja, C. O., Butarbutar, T. V., Betaubun, A. M., & Wardhani. P. (2020). Comparison of Malaria Microscopy and Polymerase Chain Reaction for Identification of Plasmodium in Papua, Indonesia. Systematic Reviews in Pharmacy, 11(06). doi: 10.31838/srp.2020.6.16

35. Shankar, H., Singh, M. P., Phookan, S., Singh, K., & Mishra, N. (2021). Diagnostic performance of rapid diagnostic test, light microscopy and polymerase chain reaction during mass survey conducted in low and high malaria-endemic areas from two North-Eastern states of India. Parasitology Research, 120(6), 2251–2261. doi: 10.1007/s00436-021-07125-8


Article Metrics

Metrics Loading ...

Metrics powered by PLOS ALM

Refbacks

  • There are currently no refbacks.


Bookmark and Share


Copyright (c) 2023 Ismail Muhammad, Tanko Mahmoud Mohammed, Asiya Muhammad Usman, Bala Abubakar

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.